Online Tution   »   Ncert Solutions Class 12 Biology Chapter...

Ncert Solutions For Class 12 Biology Chapter 6 in Hindi | Download Free PDF

Ncert Solutions For Class 12 Biology in Hindi_30.1
Ncert Solutions For Class 12 Biology Chapter 6

Ncert Solutions For Class 12 Biology Chapter 6 in Hindi

कक्षा 12 जीव विज्ञान एनसीईआरटी समाधान: Adda 247 कक्षा 12 जीव विज्ञान के लिए NCERT समाधान प्रदान करता है जो उन छात्रों के लिए है जो जीवन में आगे बढ़ना चाहते हैं और अपनी परीक्षाओं में अच्छे अंक प्राप्त करना चाहते हैं। कक्षा 12 के लिए एनसीईआरटी समाधान उन शिक्षकों द्वारा प्रदान किए जाते हैं जो अपने विषयों के विशेषज्ञ हैं। समाधान एनसीईआरटी कक्षा 12 जीव विज्ञान द्वारा तैयार किए गए नियमों के अनुसार और प्रत्येक छात्र द्वारा समझी जाने वाली भाषा में निर्धारित किए जाते हैं। इन समाधानों को पढ़कर छात्र आसानी से एक मजबूत आधार बना सकते हैं। एनसीईआरटी कक्षा 12 जीव विज्ञान समाधान महत्वपूर्ण प्रश्नों और उत्तरों के साथ अध्याय 1 से 16 तक विस्तृत तरीके से शामिल हैं।

परीक्षा कुछ लोगों के लिए खतरनाक हो सकती है, अवधारणाओं का उचित ज्ञान परीक्षा को क्रैक करने की कुंजी है। छात्र Adda 247 द्वारा प्रदान किए गए NCERT के समाधानों पर भरोसा करते हैं। समाधान उन विषयों के विशेषज्ञों द्वारा तैयार किए जाते हैं जिन्हें अपने विषयों का जबरदस्त ज्ञान होता है।

कक्षा 12 के ये एनसीईआरटी समाधान छात्रों को पाठ्यपुस्तकों से परिचित कराने में मदद करते हैं। छात्र आसानी से वेब ब्राउज़ करते हुए कहीं भी समाधानों का उपयोग कर सकते हैं। समाधान बहुत सटीक और सटीक हैं।

 

कक्षा 12 जीव विज्ञान अध्याय 6 के लिए एनसीईआरटी समाधान – वंशागति का आणविक आधार

 

अध्याय के बारे में जानकारी प्रदान करता है विरासत का आणविक आधार. डीएनए डीऑक्सीराइबोन्यूक्लियोटाइड्स का एक लंबा बहुलक है। डीएनए की लंबाई को आमतौर पर इसमें मौजूद न्यूक्लियोटाइड्स (या न्यूक्लियोटाइड की एक जोड़ी जिसे बेस पेयर कहा जाता है) की संख्या के रूप में परिभाषित किया जाता है। नाभिक में डीएनए एक अम्लीय पदार्थ है। इसे पहली बार 1869 में फ्रेडरिक मीशर द्वारा पहचाना गया था। उन्होंने इसे ‘न्यूक्लिन’ नाम दिया था। 1953 में डीएनए की डबल हेलिक्स संरचना जेम्स वॉटसन और फ्रांसिस क्रिक द्वारा दी गई थी, जो मौरिस विल्किंस और रोजालिंड फ्रैंकलिन द्वारा निर्मित एक्स-रे विवर्तन डेटा पर आधारित थी।

Download Full PDF of Class 12 Biology Chapter 6

×
×

Download your free content now!

Download success!

Ncert Solutions For Class 12 Biology in Hindi_50.1

Thanks for downloading the guide. For similar guides, free study material, quizzes, videos and job alerts you can download the Adda247 app from play store.

कक्षा 12 जीव विज्ञान अध्याय 6 के लिए एनसीईआरटी समाधान की विशेषताएं – वंशागति का आणविक आधार

 

प्रश्न पर महत्वपूर्ण जानकारी के आधार पर कक्षा 12 के NCERT Solutions के उत्तर दिए गए हैं।

  • जहां भी आवश्यक हो कॉलम का उपयोग किया जाता है।
  • समाधान बिंदुवार हल किए जाते हैं और सटीक उत्तर बिंदु से बिंदु तक होते हैं।

 

वंशागति का आणविक आधार के महत्वपूर्ण प्रश्न

प्रश्न 1. निम्नलिखित को नाइट्रोजनी क्षार और न्यूक्लियोसाइड के रूप में समूहित करें:

एडेनिन, साइटिडीन, थाइमिन, गुआनोसिन, यूरैसिल और साइटोसिन।

 

उत्तर: डीएनए न्यूक्लियोटाइड्स का एक बहुलक है जो चीनी, एक नाइट्रोजनस बेस और एक फॉस्फेट की मात्रा से बना होता है। डीएनए के चार आधार होते हैं; दो प्यूरीन और दो पाइरीमिडीन। दो प्यूरीन अर्थात् एडेनिन और ग्वानिन हैं और दो पाइरीमिडाइन साइटोसिन, थाइमिन हैं। फॉस्फेट समूह के बिना एक न्यूक्लियोटाइड इकाई को न्यूक्लियोसाइड कहा जाता है। नाइट्रोजनी क्षारक = एडेनिन, थाइमिन, यूरैसिल और साइटोसिन। साइटिडीन और गुआनोसिन न्यूक्लियोसाइड हैं।

 

प्रश्न 2. यदि दोहरे फंसे डीएनए में 20 प्रतिशत साइटोसिन है, तो डीएनए में एडेनिन के प्रतिशत की गणना करें।

 

उत्तर: एक डीएनए अणु में साइटोसिन अणुओं की संख्या ग्वानिन अणुओं के बराबर होती है और एडेनिन अणुओं की संख्या थाइमिन अणुओं के बराबर होती है। इस प्रकार, यदि एक डबल स्ट्रैंडेड डीएनए में 20% साइटोसिन होता है, तो इसमें 20% गुआनिन होता है। इस प्रकार, C + G कुल आधारों का 40% बनाता है। शेष 60% में एडेनिन और थाइमिन दोनों शामिल हैं जो समान मात्रा में हैं। तो, एडेनिन का प्रतिशत 30% है।

 

प्रश्न 3. यदि DNA के एक रज्जुक का क्रम इस प्रकार लिखा जाता है:

5एटीजीसीएटीजीसीएटीजीसीएटीजीसीएटीजीसीएटीजीसीएटीजीसी-3

पूरक रज्जुक के अनुक्रम को 5′ में लिखिए।3 दिशा।

 

उत्तर: डीएनए एक दो-असहाय अणु है। प्रत्येक स्ट्रैंड ए (एडेनोसिन), टी (थाइमिडीन), सी (साइटिडीन), और जी (ग्वानोसिन) अवशेषों से बना एक पोलीन्यूक्लियोटाइड होता है, जो विशिष्ट अनुक्रमों के साथ रैखिक श्रृंखलाओं में “निर्जलीकरण” संश्लेषण द्वारा पोलीमराइज़ किया जाता है। प्रत्येक स्ट्रैंड में ध्रुवता होती है जो 5 . से चलती है’ 3 . तक’.

डीएनए में, टी के साथ ए पीआईआर और सी के साथ जी जोड़े।

मूल 5 . के माध्यम से एफओ’ 3 . तक’ अनुक्रम प्रत्येक ए को टी विज्ञापन के साथ प्रत्येक सी को जी के साथ जोड़ता है।

जबकि RNA सिंगल स्ट्रैंड अणु है। इस स्ट्रैंड में ए, सी, जी और यू (यूरिडीन) से बना पोलीन्यूक्लियोटाइड भी होता है।

एक पूरक स्ट्रैंड के लिए A को U से बदलें (क्योंकि RNA में T नहीं है), T को A से बदलें, सी के साथ जी, और जी के साथ सी।

इसलिए, यदि डीएनए के एक रज्जुक के अनुक्रम को इस प्रकार लिखा जाता है:

5′ -एटीजीसीएटीजीसीएटीजीसीएटीजीसीएटीजीसीएटीजीसीएटीजीसी-3′

3 . में पूरक स्ट्रैंड का क्रम’ -> 5′ इस प्रकार है:

3′ – TACGTACGTACGTACGTACGTACGTACG – 5′

इसके बाद, 5′ में पूरक स्ट्रैंड का क्रम→3′ दिशा इस प्रकार लिखी जाती है:

5′ – GCATGCATGCATGCATGCATGCATGCAT – 3′

 

प्रश्न 4. यदि प्रतिलेखन इकाई में कोडिंग स्ट्रैंड का क्रम निम्नानुसार लिखा जाता है:

5एटीजीसीएटीजीसीएटीजीसीएटीजीसीएटीजीसीएटीजीसीएटीजीसी-3

mRNA के अनुक्रम को लिखिए।

 

उत्तर:

यदि प्रतिलेखन इकाई में कोडिंग स्ट्रैंड 5 . है’-एटीजीसीएटीजीसीएटीजीसीएटीजीसीएटीजीसीएटीजीसीएटीजीसी-3′

फिर, 3 ‘से 5′ दिशा में टेम्पलेट स्ट्रैंड होगा

3′-TACGTACGTACGTACGTACGTACGTACG-5′

यह ज्ञात है कि एमआरएनए का अनुक्रम डीएनए के कोडिंग स्ट्रैंड के समान है। हालांकि, आरएनए में, थाइमिन को यूरैसिल द्वारा प्रतिस्थापित किया जाता है।

अत: mRNA का अनुक्रम होगा

5′-एयूजीसीएयूजीसीएयूजीसीएयूजीएयूजीसीयूजीसीयूजीसी-3’

 

प्रश्न 5. डीएनए डबल हेलिक्स की किस संपत्ति ने वाटसन और क्रिक को डीएनए प्रतिकृति के अर्धरूढ़िवादी मोड की परिकल्पना के लिए प्रेरित किया? समझाओ।

 

उत्तर: वाटसन और क्रिक ने देखा कि डीएनए के दो स्ट्रैंड समानांतर हैं और उनके आधार अनुक्रमों के संबंध में एक दूसरे के पूरक हैं। डीएनए अणु में इस प्रकार की व्यवस्था ने इस परिकल्पना को जन्म दिया कि डीएनए प्रतिकृति अर्ध-रूढ़िवादी है। इसका मतलब है कि डबल-स्ट्रैंडेड डीएनए अणु अलग हो जाता है और फिर, अलग-अलग स्ट्रैंड में से प्रत्येक एक नए पूरक स्ट्रैंड के संश्लेषण के लिए एक टेम्पलेट के रूप में कार्य करता है। नतीजतन, प्रत्येक डीएनए अणु में एक पैतृक स्ट्रैंड और एक नया संश्लेषित बेटी स्ट्रैंड होगा। चूँकि प्रत्येक संतति अणु में केवल एक पैतृक तंतु संरक्षित होता है, इसे प्रतिकृति की अर्ध-रूढ़िवादी विधा के रूप में जाना जाता है।

Ncert Solutions For Class 12 Biology in Hindi_60.1
Ncert solution for class 12 biology chapter 6

प्रश्न 6. टेम्पलेट की रासायनिक प्रकृति (डीएनए या आरएनए) और उससे संश्लेषित न्यूक्लिक एसिड की प्रकृति (डीएनए या आरएनए) के आधार पर, न्यूक्लिक एसिड पोलीमरेज़ के प्रकारों की सूची बनाएं।

 

उत्तर: न्यूक्लिक एसिड पोलीमरेज़ दो प्रकार के होते हैं:

ए। डीएनए पर निर्भर डीएनए पोलीमरेज़

बी डीएनए पर निर्भर आरएनए पोलीमरेज़

डीएनए पर निर्भर डीएनए पोलीमरेज़ एक नए डीएनए स्ट्रैंड को संश्लेषित करने के लिए डीएनए टेम्पलेट का उपयोग करता है और डीएनए पर निर्भर आरएनए पोलीमरेज़ एक नए आरएनए स्ट्रैंड को संश्लेषित करने के लिए डीएनए टेम्पलेट का उपयोग करता है।

 

प्रश्न 7. हर्शे और चेज़ ने अपने प्रयोग में डीएनए और प्रोटीन के बीच अंतर कैसे किया, यह साबित करते हुए कि डीएनए आनुवंशिक सामग्री है?

 

उत्तर: हर्शे और चेज़ ने डीएनए की पहचान करने के लिए रेडियोधर्मी फास्फोरस (32P) वाले माध्यम पर कुछ बैक्टीरियोफेज विकसित किए और कुछ ने प्रोटीन की पहचान करने के लिए रेडियोधर्मी सल्फर (35S) वाले माध्यम पर। फिर इन रेडियोधर्मी-लेबल वाले चरणों को सेंट्रीफ्यूजेशन की प्रक्रिया के अधीन ई। कोलाई बैक्टीरिया को संक्रमित करने की अनुमति दी गई।

इसने एक विचार दिया कि डीएनए वंशानुगत सामग्री के रूप में कार्य करता है जो बैक्टीरियोफेज से बैक्टीरिया में प्रेषित होता है। बैक्टीरियोफेज से संक्रमित बैक्टीरिया में रेडियोधर्मी प्रोटीन होते थे।

 

प्रश्न 8.निम्नलिखित के बीच अंतर करें:

() दोहरावदार डीएनए और सैटेलाइट डीएनए

(बी) एमआरएनए और टीआरएनए

(सी) टेम्पलेट स्ट्रैंड और कोडिंग स्ट्रैंड

 

उत्तर: ()दोहरावदार डीएनए और उपग्रह डीएनए

दोहरावदार डीएनए सैटेलाइट डीएनए
दोहराए जाने वाले डीएनए डीएनए अनुक्रम होते हैं जिनमें छोटे खंड होते हैं, जिन्हें कई बार दोहराया जाता है। सैटेलाइट डीएनए डीएनए अनुक्रम होते हैं जिनमें अत्यधिक दोहराव वाला डीएनए होता है।

 

(बी)एमआरएनए और टीआरएनए

एमआरएनए टीआरएनए
एमआरएनए या मैसेंजर आरएनए प्रतिलेखन की प्रक्रिया के लिए एक टेम्पलेट के रूप में कार्य करता है। टीआरएनए या ट्रांसफर आरएनए एक एडेप्टर अणु के रूप में कार्य करता है जो पॉलीपेप्टाइड के संश्लेषण के लिए एक विशिष्ट अमीनो एसिड को एमआरएनए में ले जाता है।
यह एक रैखिक अणु है। इसमें तिपतिया घास के पत्ते का आकार होता है।

 

(सी)टेम्प्लेट स्ट्रैंड और कोडिंग स्ट्रैंड

टेम्पलेट किनारा कोडिंग स्ट्रैंड
डीएनए का टेम्प्लेट स्ट्रैंड ट्रांसक्रिप्शन के दौरान एमआरएनए के संश्लेषण के लिए एक टेम्पलेट के रूप में कार्य करता है। कोडिंग स्ट्रैंड डीएनए का एक अनुक्रम है जिसमें एमआरएनए के समान आधार अनुक्रम होता है (थाइमिन को छोड़कर जिसे डीएनए में यूरैसिल द्वारा प्रतिस्थापित किया जाता है)।
यह 3′ से 5′ तक चलता है। यह 5′ से 3′ तक चलता है।

 

प्रश्न 9. अनुवाद के दौरान राइबोसोम की दो आवश्यक भूमिकाओं की सूची बनाएं।

 

उत्तर: अनुवाद के दौरान राइबोसोम के महत्वपूर्ण कार्य इस प्रकार हैं।

राइबोसोम उस साइट के रूप में कार्य करता है जहां व्यक्तिगत अमीनो एसिड से प्रोटीन संश्लेषण होता है। यह दो उप-इकाइयों से मिलकर बना है।

छोटा सबयूनिट mRNA के संपर्क में आता है और एक प्रोटीन संश्लेषण कॉम्प्लेक्स बनाता है जबकि बड़ा सबयूनिट अमीनो एसिड बाइंडिंग साइट के रूप में कार्य करता है।

राइबोसोम पेप्टाइड बॉन्ड बनाने के लिए उत्प्रेरक का काम करता है। उदाहरण के लिए, बैक्टीरिया में 23s r-RNA एक राइबोजाइम के रूप में कार्य करता है।

 

प्रश्न 10. जिस माध्यम में ई. कोलाई बढ़ रहा था, उसमें लैक्टोज मिलाया गया, जिससे लैक ऑपेरॉन प्रेरित हुआ। फिर, माध्यम में लैक्टोज मिलाने के कुछ समय बाद लैक ऑपेरॉन क्यों बंद हो जाता है?

 

उत्तर: इंड्यूसर एक रसायन (सब्सट्रेट, हार्मोन या कोई अन्य मेटाबोलाइट) है जो दमनकर्ता के संपर्क में आने के बाद बाद वाले को गैर-डीएनए बाध्यकारी अवस्था में बदल देता है ताकि ऑपरेटर जीन को मुक्त किया जा सके। एस्चेरिचिया कोलाई के लैक-ओपेरॉन के लिए उत्प्रेरक लैक्टोज है (वास्तव में एलोलैक्टोज, या लैक्टोज का मेटाबोलाइट)। आरएनए पोलीमरेज़ को प्रमोटर जीन द्वारा मान्यता प्राप्त है। यह मुक्त ऑपरेटर जीन के ऊपर से गुजरता है और फिर संरचनात्मक जीन पर mRNAs के प्रतिलेखन को उत्प्रेरित करता है। एमआरएनए साइटोप्लाज्म में गुजरता है और विशेष प्रोटीन या एंजाइम बनाता है। लैक-ओपेरॉन द्वारा उत्पादित तीन एंजाइमों में से, पर्मीज़ सेल के अंदर लैक्टोज लाने के लिए होता है। galactosidase (=lactase) लैक्टोज को दो घटकों, ग्लूकोज और गैलेक्टोज में तोड़ता है। लैक्टेज या गैलेक्टोसिडेज जैसे एंजाइम जो इसके सब्सट्रेट की उपस्थिति के जवाब में बनते हैं, अक्सर इंड्यूसिबल एंजाइम कहलाते हैं। इंड्यूसिबल ऑपेरॉन सिस्टम आमतौर पर कैटोबोलिक पाथवे में होते हैं। हालांकि, लैक-ओपेरॉन बाहरी वातावरण में लैक्टोज की उपस्थिति के बावजूद अनिश्चित काल तक सक्रिय नहीं रहेगा। यह कोशिका में ग्लूकोज और गैलेक्टोज के उनके चयापचय के लिए बैक्टीरिया की क्षमता से परे संचय के साथ अपनी गतिविधि को रोक देगा।

एनसीईआरटी सोलूशन्स क्लास 12 जीव विज्ञान अध्याय 6 पर अक्सर पूछे जाने वाले प्रश्न

 

कक्षा 12 जीव विज्ञान अध्याय 6 के लिए NCERT Solutions को रेफर करने के क्या फायदे हैं?

Adda 247 द्वारा कक्षा 12 के NCERT Solutions को संदर्भित करने वाले छात्र परीक्षा के दौरान उपयोगी समाधान पाते हैं। समाधान विशेषज्ञों द्वारा छात्रों को ध्यान में रखते हुए इंटरैक्टिव तरीके से तैयार किए जाते हैं। समाधान तैयार करते समय छात्रों के दृष्टिकोण को ध्यान में रखा जाता है। यह समय पर पाठ्यक्रम को पूरा करने में मदद करता है और परीक्षा से पहले संशोधन के लिए नोट्स भी प्रदान करता है।

 

जेईई और एआईपीएमटी जैसी प्रतियोगी परीक्षाओं में एनसीईआरटी को रेफर करने के क्या फायदे हैं?

 

एनईईटी, जेईई इत्यादि जैसी अधिकांश प्रतियोगी परीक्षाएं अपने प्रश्न पत्रों को डिजाइन करने के लिए मूल एनसीईआरटी किताबों का पालन करती हैं। एनसीईआरटी एनईईटी और जेईई के लिए तैयार प्रत्येक पुस्तक के आधार के रूप में कार्य करता है। प्रतियोगी परीक्षाएं ग्यारहवीं और बारहवीं कक्षाओं में लागू सीबीएसई पाठ्यक्रम पर आधारित होती हैं और एनसीईआरटी की किताबें सीबीएसई पाठ्यक्रम का सख्ती से पालन करती हैं। इसके अलावा, सैद्धांतिक अवधारणाओं को स्पष्ट करने में एनसीईआरटी की किताबें महत्वपूर्ण भूमिका निभाती हैं। एनसीईआरटी की किताबों में दिए गए हर विषय को इस तरह से समझाया गया है जिससे छात्रों को उनकी मूल बातें और बुनियादी बातों को मजबूत और स्पष्ट बनाने में मदद मिल सके।

 

एनसीईआरटी की पुस्तकों को अधिक कुशलता से कैसे पढ़ें?

 

नीचे दिए गए महत्वपूर्ण बिंदु हैं जिनका पालन एनसीईआरटी की पुस्तकों को कुशल तरीके से पढ़ते समय किया जाना चाहिए:

उस विशेष विषय में उल्लिखित प्रत्येक पंक्ति के अर्थ और महत्व को समझकर प्रत्येक विषय का अच्छी तरह से अध्ययन करें।

यदि कोई शंका हो तो अपने शिक्षक से पूछें।

परीक्षा के समय संशोधित करने के लिए महत्वपूर्ण विषयों को नोट करें।

प्रत्येक अध्याय के अंत में दिए गए सभी अभ्यास प्रश्नों को हल करें। अवधारणाओं को बेहतर तरीके से समझने के लिए ये प्रश्न महत्वपूर्ण हैं।

 

क्या प्रत्येक अध्याय के अंत में उल्लिखित सभी एनसीईआरटी प्रश्नों को हल करना अनिवार्य है?

 

प्रत्येक अध्याय के अंत में एनसीईआरटी की पाठ्यपुस्तकों में उल्लिखित प्रश्न और उत्तर न केवल परीक्षा के लिए बल्कि अवधारणाओं को बेहतर तरीके से समझने के लिए भी काफी महत्वपूर्ण हैं। इन प्रश्नों का उद्देश्य अध्याय में सीखे गए विषयों पर छात्रों की समझ और सीखने का परीक्षण करना है।

एनसीईआरटी अभ्यास समस्याओं को हल करने में मदद मिलेगी

  • एक अध्याय में सीखी गई सभी अवधारणाओं और सूत्रों को स्पष्ट करें
  • परीक्षा में पूछे जाने वाले विभिन्न प्रकार के प्रश्नों के साथ सहज महसूस करें
  • पर्याप्त अभ्यास प्राप्त करें जो गणित की परीक्षा में सफल होने की कुंजी है
  • अपनी सटीकता और गति में सुधार करें

 

कक्षा 12 जीव विज्ञान के लिए एनसीईआरटी समाधान के अध्याय 6 में शामिल महत्वपूर्ण अवधारणाएं क्या हैं?

 

एनसीईआरटी समाधान के अध्याय 6 में शामिल अवधारणाएं हैं –

६.१-डीएनए

६.२ – आनुवंशिक सामग्री की खोज

  1. 3 – आरएनए वर्ल्ड

६.४ – प्रतिकृति

६.५ – प्रतिलेखन

६.६ – आनुवंशिक कोड

६.७ – अनुवाद

६.८ – जीन अभिव्यक्ति का विनियमन

६.९ – मानव जीनोम परियोजना

6.10-डीएनए फिंगरप्रिंटिंग

ये अवधारणाएं Adda 247 में संकाय द्वारा बनाई गई हैं। समाधान Adda 247 पर पीडीएफ प्रारूप में उपलब्ध हैं जिन्हें छात्र डाउनलोड कर सकते हैं।

Sharing is caring!

Thank You, Your details have been submitted we will get back to you.

Leave a comment

Your email address will not be published.