Class 12 Biology Answer Key 2023
Class 12 Biology Answer Key 2023: Central Board of Secondary Education has conducted the Class 12th Biology exam for the academic year 2022-23 on 16th March 2023. The time of the examination is 10:30 am to 1:30 pm. In this article, we have provided the CBSE Class 12 Biology Answer Key 2023, the answer key is prepared by the expert faculty of ADDA247 and will be available after the completion of the examination. We have provided the CBSE Class 12 Biology Answer Key 2023 on our youtube channel too. Although, students can also evaluate their scores by using the CBSE Class 12 Biology Answer Key 2023 provided on this page.
Check: Class 12 All Subjects Answer Key 2023
CBSE Class 12 Biology Answer Key 2023, Set 1, 2,3
Class 12 Biology Answer key & Exam Analysis: Students’ Reaction
The CBSE class 12th Biology examination concluded at 1:30 p.m. Teachers’ and experts’ analyses of Class 12 Biology Answer Key 2023, as well as students’ reactions, given here.
We speak with students who are taking the class 12 biology exam. The overall paper was rated ‘Easy to Moderate’ by the majority of students. The paper was easy because there were numerous direct NCERT questions. The MCQs were the simplest. Nonetheless, the application-based questions were a little difficult. Students said the majority of the paper was simple, but Section C (case-based questions) was challenging.
Class 12 Biology Answer key 2023 for All Sets
Here we provide you the Class 12 Biology Answer key for Section A Multiple Choice Questions. With the help of the Class 12 Biology Answer key for Section A, candidates can cross-check their answers with the answer key and predict their scores.
| Class 12 Biology Answer key for Section A | ||
| Question No. | Question Code: 57/5/2 | Question Code: 57/3/3 |
| 1 | (c) Viral infected cells | (c) Point Q |
| 2 | (d) Haemophilius influenzae : Blockage of the internal passage |
(a) Perisperm |
| 3 | (c) K cal m-2 yr-1 | (b) Most fertile days: 10 – 17, Least fertile days: 21 – 28 |
| 4 | (c) X – Suspensor (2n), Y – Cotyledon (2n), Z – Radicle (2n), U – Plumule (2n). |
(a) Ferns |
| 5 | (b) (A)-(ii), (B)-(i), (C)-(iv), (D)- (iii) | (c) S35 |
| 6 | (b) Neanderthal man | (b) Individuals 1 and 2 |
| 7 | (a) Phenylalanine, Methionine | (c) (iii) only – Step ‘R’ is an extension of DNA in presence of thermostable DNA polymerase. |
| 8 | (c) Mutualism | Invalid options |
| 9 | (d) (i) and (iv) | (a) (i) and (iv) only |
| 10 | (c) Amphibian | (b) Jaintia Hills in Meghalaya |
| 11 | (d) 5′ C – T – G – C – A, G 3′, 3′ G,A – C – G – T – C 5′ | (a) (ii), (iii), and (iv) only |
| 12 | (d) (A)-(ii), (B)-(iv), (C)-(i), (D)-(iii) | (a) Convergent evolution |
| 13 | (d) (A) is false, but (R) is true. | (a) Both (A) and (R) are true and (R) is the correct explanation of A. |
| 14 | (d) (A) is false, but (R) is true. | (b) Both (A) and (R) are true but (R) is not the correct explanation of A. |
| 15 | (d) (A) is false, but (R) is true. | (d) (A) is false, but (R) is true. |
| 16 | (c) (A) is true, but (R) is false. | (a) Both (A) and (R) are true and (R) is the correct explanation of A. |
Class 12 Biology Answer Key and Exam Pattern 2023
Before analysis of the Class 12 Biology Answer Key 2023 candidates must well know the Class 12 Biology question paper. The Biology Question paper will be worth 70 points and will take 3 hours to complete.The paper will contain 33 questions broken into five sections:
Section A: 16 questions worth 1 mark each,
Section B: 5 questions worth 2 marks each,
Section C: 7 questions worth 3 marks each,
Section D: 2 case-based questions worth 4 marks each, and
Section E: 3 questions worth 5 marks each.
All questions will be mandatory to attempt, with a few internal alternatives in some. Students are encouraged to tackle CBSE Class 12 Biology Sample Paper Questions 2022-23 in order to do well in the final CBSE Class 12 Biology Board exam. The Class 12 Biology test will include MCQs, assertion-reason-based questions, and case study-based questions. This Question paper design will help students to calculate their predicted scores with the Class 12 Biology Answer Key.
Expected Class 12 Biology Board Exam Paper 2023
Class 12 Biology Question Paper 2023 Set 1 ( 57/5/1 )
Class 12 Biology Answer Key 2023 Set 1 (Paper Code- 57/5/1)
1. Given below are Column A with a list of certain Assisted Reproductive Technologies (ART) and in Column B the procedures followed during ART:
| Column A | Column B |
| A GIFT | (i) Transfer of ovum from a donor into the fallopian tube of another female. |
| B ICSI | (ii) Transfer of semen from the donor into the vagina of the female. |
| C ZIFT | (iii) Injecting sperms directly into the ovum. |
| D IUI | (iv) Transfer of early embryos into the fallopian tube. |
Choose the option where ART correctly matches with the procedure.
a) (A)–(i), (B)–(ii), (C)–(iii), (D)–(iv)
b) (A)–(iv), (B)–(i), (C)–(ii), (D)–(iii)
c) (A)–(iv), (B)–(iii), (C)–(i), (D)–(ii)
(d) (A)–(i), (B)–(iii), (C)–(iv), (D)–(ii)
Correct Answer- (d) (A)-(i), (B)-(iii), (C)-(iv), (D)-(ii)
2..The decrease in the T-lymphocytes count in human blood will result in:
a) Decrease in antigens
b) Decrease in antibodies
c) Increase in antibodies
d) Increase in antigens
Correct Answers- d) Increase in antigens
3. At which stage evolution did humans use hides to protect their bodies and buried their dead?
a) Homo habilis
b) Neanderthal man
c) Java man
d) Homo erectus
Correct Answer- b) Neanderthal man
4. The primary productivity in an ecosystem is expressed as:
a) gm-2 yr-1
b) K cal m-2
c) gm-2 yr
d) Kcal m-2 yr-1
Correct Answer- (b) K cal m-2
5. A Tight one-to-one relationship between many species of fig tree and certain wasps is an example of –
(a) Commensalism
(b) Parasitism
(c) Amensalism
d) Mutualism
Correct Answers- d) Mutualism
6. Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3‘ AUCAGGUUUGUGAUGGUACGA 5‘
a) Phenylalanine, Methionine
b) Cysteine, Glycine
c) Alanine, Proline
d) Serine, Valine
Correct Answers- c) Alanine, Proline
7. Select the pathogen mismatched with the symptoms of disease caused by it from the list given below
(a) Entamoeba histolvtica : Constipation, abdominal pain.
(b) Epidermophyton: Dry scaly lesions on nail
(c) Wuchereria bancrofti: Chronic inflammation of lymphatic vessels of lower limb
(d) Haemophilus influenzae : Blockage of the intestinal passage.
Correct Answer- (d) Haemophilus influenzae : Blockage of the intestinal passage.
Class 12 Biology Question Paper 2023 Set 2 (57/5/2)
Class 12 Biology Question Paper 2023 Set 3 (57/3/3)
CBSE Class 12 Biology Answer Key 2023 Set 3 (57/3/3)
SECTION A
Select the option of days on which this woman would be most and least fertile.
6. DNA profiles of the child and three individuals 1, 2 and 3 who claim to be the parents of the child are given below. Select the option that shows the correct actual parent/parents of the child.
CBSE Class 12 Biology Answer Key 2023 Question Paper Analysis
Candidates rush to find the Class 12 Biology Answer key 2023 after the exam is over. For the benefit of the students, we have provided you the Class 12 Biology Answer key 2023 for all sets and Exam analysis. The CBSE Class 12 Biology test will take place between 10:30 and 1:30. After the test is over, students can view the CBSE Class 12 Biology Exam Analysis 2023. In the CBSE Class 12 Biology Exam Analysis 2023, we will evaluate the question paper based on its difficulty level and out-of-syllabus questions. Stay in touch with us.
Biology Class 12 Answer Key 2023
Students taking the Class 12th Biology exam on March 16, 2023, must review their answers using the Class 12 biology answer key 2023 provided on this page. Because we are the first to provide answer keys for all the topics before anybody else, students do not need to rush to other websites in order to find the Class 12 biology Answer Key 2023. Instead, they should bookmark this page and refresh frequently. Check out the details in the table below:
| Biology Class 12 Answer Key 2023 | |
| Exam Conducting Body | Central Board of Secondary Education |
| Exam & Subject Name | CBSE Class 12 Biology |
| Category | Answer Key |
| Exam Date | 16th March 2023 |
| Unofficial Answer Key | 16th March 2023 |
| Official Answer Key | To be notified |
| Official Website | https://www.cbse.nic.in/ |
Biology Class 12 Answer Key with Paper Solution 2023
Whenever the CBSE Class 12 Biology Test 2023 is over, we have given the detailed 100% correct CBSE Class 12 Biology Answer key 2023 with question paper analysis as soon as possible. Bookmark this page to obtain the CBSE Class 12 Biology answer key for all sets at your fingertip.
Class 12th Boards Ka Vardaan eBook By adda247
Class 12 Biology Question Papers 2023 PDF Download
We will provide the CBSE Class 12 Biology Question Papers 2023 Pdf in this section. Applicants can compute their expected results by downloading Class 12 Biology Question Papers and analyzing the Class 12 Biology Answer Key.
| CBSE Class 12 Biology Question Papers 2023 Pdf Download |
| CBSE 12 Biology Question Papers 2023- Set 1 |
| CBSE 12 Biology Question Papers 2023- Set 2 |
| CBSE 12 Biology Question Papers 2023- Set 3 |
- Chemistry Class 12 Answer Key 2023, Question Paper Set 1, 2, 3
- Class 12 English Answer key 2023, Question Papers Set 1 & 3
In question paper code 057/1/4
I can’t se last two row’s answers
Please check 057/3/4 , Q 14 , drosophila does exhibit linkage . Furthermore the same choice in the other sets is correct which confirms that b is not the answer . Neither is a the answer .
Please do check 057/3/4 , Q 14 , drosophila does exhibit linkage . Furthermore the same choice in the other sets is correct which confirms that b is not the answer . Neither is a the answer .
Please do check 057/3/4 , Q 14 , drosophila does exhibit linkage . Furthermore the same choice in the other sets is correct which confirms that b is not the answer . Neither is a the answer .