arrow
arrow
arrow
Given below is a DNA sequence:5′ – ATGCGATGACGATTGACGATGACGATAGAC – 3′ In the absence of any other affecting parameters such as length, Tₘ, GC-content
Question

Given below is a DNA sequence:
5′ – ATGCGATGACGATTGACGATGACGATAGAC – 3′
In the absence of any other affecting parameters such as length, Tₘ, GC-content, which one of the following combinations of PCR primer sequences would be able to amplify the above fragment?

A.

5′ – TACGCTAC – 3′ and 5′ – CGATAGAC – 3′

B.

5′ – GTCTATCG – 3′ and 5′ – ATGCGATG – 3′

C.

5′ – ATGCGATG – 3′ and 5′ – CAGATAGC – 3′

D.

5′ – CATCGCAT – 3′ and 5′ – CGATAGAC – 3′

Correct option is B

The correct answer is: (2) 5'– GTCTATCG–3' and 5'– ATGCATG–3'

Explanation:
In PCR, the primers need to bind to complementary sequences on opposite strands of the DNA, ensuring that the DNA polymerase can extend the primers and amplify the desired fragment. Given the DNA sequence:

5'– ATGCATGACGATTGACGATGACGATAGAC–3'

  • The forward primer (5'– GTCTATCG–3') should match the complementary sequence near the 3' end of the forward strand, which is near the beginning of the given DNA sequence.

  • The reverse primer (5'– ATGCATG–3') is complementary to the 3' end of the given sequence, ensuring that both primers bind correctly to their respective strands, allowing amplification of the fragment.

These primers are the best match to the given DNA sequence and will amplify the desired region in PCR.

Analysis of Other Options:

  • Option 1 (5'– TACGCTAC–3' and 5'– CGATAGAC–3'): The forward primer (5'– TACGCTAC–3') does not match the start of the sequence, which would prevent effective amplification.

  • Option 3 (5'– ATGCGATG–3' and 5'– CAGATAGC–3'): Although the forward primer is complementary, the reverse primer does not bind to the correct complementary sequence in the provided DNA, making this option less effective.

  • Option 4 (5'– CATCGCAT–3' and 5'– CGATAGAC–3'): The forward primer (5'– CATCGCAT–3') does not match the sequence, and the reverse primer also does not correctly match the 3' end of the complementary strand.

Conclusion:
Option (2) is the correct answer because it provides the proper complementary primers for both strands of the DNA sequence, allowing efficient amplification of the desired region in PCR.

Similar Questions

test-prime-package

Access ‘CSIR NET Life Sciences’ Mock Tests with

  • 60000+ Mocks and Previous Year Papers
  • Unlimited Re-Attempts
  • Personalised Report Card
  • 500% Refund on Final Selection
  • Largest Community
students-icon
368k+ students have already unlocked exclusive benefits with Test Prime!
test-prime-package

Access ‘CSIR NET Life Sciences’ Mock Tests with

  • 60000+ Mocks and Previous Year Papers
  • Unlimited Re-Attempts
  • Personalised Report Card
  • 500% Refund on Final Selection
  • Largest Community
students-icon
368k+ students have already unlocked exclusive benefits with Test Prime!
Our Plans
Monthsup-arrow