arrow
arrow
arrow
A DNA sequence is given below:5’ – ATGACGATGACGAGACGATGCAGATGATAGCAGTAGCGAATGAC – 3’The following primers were designed to amplify the above sequence:
Question

A DNA sequence is given below:

5’ – ATGACGATGACGAGACGATGCAGATGATAGCAGTAGCGAATGAC – 3’

The following primers were designed to amplify the above sequence:

  • A. 5’ – TACTGCT – 3’

  • B. 5’ – CAGTAAG – 3’

  • C. 5’ – ATGACGA – 3’

  • D. 5’ – GTCATTC – 3’

  • E. 5’ – TCGTCAT – 3’

  • F. 5’ – GAATGAC – 3’

If we negate the effects of primer length, Tm, %GC, and other factors, which one of the following options represents a combination of primers that could amplify the above DNA sequence?

A.

A and C

B.

B and D

C.

E and F

D.

C and D

Correct option is D

To determine which combinations of primers can amplify the provided DNA sequence, we will analyze each primer for complementarity to the target sequence.

Given DNA Sequence:

5’ –ATGACGATGACGAGACGATGCAGATGATAGCAGTAGCGAATGAC – 3’

Primers:

  1. A. 5’ – TACTGCT – 3’

  2. B. 5’ – CAGTAAG – 3’

  3. C. 5’ – ATGACGA – 3’

  4. D. 5’ – GTCATTC – 3’

  5. E. 5’ – TCGTCAT – 3’

  6. F. 5’ – GAATGAC – 3’

Analysis of Each Primer:

  • Primer A: 5’ – TACTGCT – 3’

    • This primer would bind to the complementary sequence of the original DNA (from 3’ to 5’), which is 5’ – AGCAGTA - 3’.

    • The exact complementary sequence is not present in the given DNA strand.

  • Primer B: 5’ – CAGTAAG – 3’

    • This primer would bind to the complementary sequence 5’ – CTACTG – 3’.

    • The exact complementary sequence is not present in the given DNA strand.

  • Primer C: 5’ – ATGACGA – 3’

    • This primer exactly matches the beginning of the DNA sequence (5’ – ATGACGA – 3’).

    • Therefore, Primer C can bind to the 5’ end of the original sequence.

  • Primer D: 5’ – GTCATTC – 3’

    • This primer would bind to the complementary sequence 5’ – GAATGAC – 3’.

    • This sequence is present toward the end of the given DNA sequence at the 3’ end, allowing Primer D to bind at the 3’ end.

  • Primer E: 5’ – TCGTCAT – 3’

    • This primer would bind to the complementary sequence 5’ – ATGACGA – 3’, which appears in the original DNA. However, Primer C binds more effectively at the 5’ end of the DNA.

  • Primer F: 5’ – GAATGAC – 3’

    • This primer exactly matches the complementary sequence of the 3’ end of the DNA sequence (5’ – GTCATTC – 3’), meaning it can bind at the 3’ end.

The correct combination of primers that could amplify the DNA sequence is C and D.

Similar Questions

test-prime-package

Access ‘CSIR NET Life Sciences’ Mock Tests with

  • 60000+ Mocks and Previous Year Papers
  • Unlimited Re-Attempts
  • Personalised Report Card
  • 500% Refund on Final Selection
  • Largest Community
students-icon
368k+ students have already unlocked exclusive benefits with Test Prime!
test-prime-package

Access ‘CSIR NET Life Sciences’ Mock Tests with

  • 60000+ Mocks and Previous Year Papers
  • Unlimited Re-Attempts
  • Personalised Report Card
  • 500% Refund on Final Selection
  • Largest Community
students-icon
368k+ students have already unlocked exclusive benefits with Test Prime!
Our Plans
Monthsup-arrow