Table of Contents
The National Testing Agency publishes the NEET Question Paper 2024 PDF at the official website of NTA at https://exams.nta.ac.in/NEET/. Students can understand the NEET questions’ difficulty level and important areas of the NEET syllabus by analyzing the NEET 2024 Question Paper.
NEET 2024 Question Paper
NEET Question Paper 2024 exam was conducted on May 5. The National eligibility cum entrance exam is held in a single shift. From 2 pm the National Merit Cum Entrance Test starts. Students are given 3 hours 20 minutes to solve the NEET Question Paper 2024. The NEET 2024 Question Paper comprises questions from 4 subjects – Zoology, Botany, Physics and Chemistry. 50 questions were asked from each subject. In each subject, there are 2 sections, Section A consists of 35 questions and section B consists of 15 questions out of which 10 must be attempted.
NEET 2024 Exam Highlights
Know the details of the NEET 2024 exam high light in the table below.
Particulars |
Details |
---|---|
Mode of the examination |
Offline |
Duration of the examination |
Three hours and Twenty Minutes (3.20 hours) |
Exam timing |
2 pm to 5.20 pm |
Type of questions |
Multiple Choice Questions (MCQs) |
Total number of Questions |
200 (180 applicable questions for attempt) |
Total Marks |
720 |
Negative marking |
Yes |
Marking Scheme |
+4 for each correct answer -1 for each incorrect answer 0 for un-attempted or extra attempted question |
Total sections in the question paper |
3 (Two sections for each subject) Section A – 35 questions Section B- 15 questions (10 to be attempted) |
NEET Subjects |
Physics, Chemistry and Biology (Botany + Zoology) |
NEET Question Paper 2024 Difficulty Level
The NEET Question paper 2024 was of moderate level. In each subject, the maximum mark in section A is 140 and a student can score a maximum of 40 marks in section B. Let’s review how was the NEET Question Paper 2024 PDF.
Subject | Difficulty Level | Most Questions were asked from- Chapters | Overall Paper Level |
Zoology | Easiest section | Human Health and Diseases, Human Reproduction, Plant Physiology, Cockroaches | Easy to Moderate |
Botany | Easy | Plant Cell, Animal cell, photo synthesis | |
Physics | Toughest Section | Mostly numerical-based questions were asked | |
Chemistry | Moderate | Organic-18, Physical -16, Inorganic-16 Questions |
Get RE NEET Question Paper 2024 PDF Download
NEET 2024 Question Paper PDF Download
We will soon publish the NEET 2024 Question Paper PDF Download links here in this section. NEET paper PDFs are significant for aspiring students who will take the NEET UG entrance exam next year. Practicing these questions PDF with solutions will help them to know the NEET Exam Pattern and difficulty level very well. Get the 2024 NEET question paper PDF from the links below.
NEET Question Paper 2024 PDF Download Link All Sets (Available Soon) |
NEET 2024 Question Paper PDF Paper Code T1 (Exact paper) |
NEET Question Paper 2024 Download Paper Code R3 (Exact Paper) |
NEET 2024 Question Paper with Answers
NEET UG 2024 question paper with Answers is complete based on the NEET updated syllabus. The NEET syllabus has undergone many changes this year. So this year’s NEET 2024 Question paper is a blueprint to guide all the future NEET aspirants.
NEET 2024 Paper with Answers
- Which of the following is an example of an actinomorphic flower?
(1) Cassia
(2) Pisum
(3) Sesbania
4 Datura
Answer – 4) Datura.
- What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?
A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.
B. It may get integrated into the genome of the recipient and be inherited along with C. It may multiply and the host DNA.
D. The alien piece of DNA is not an integral part of the chromosome.
E. It shows the ability to replicate.
Choose the correct answer from the options given below:
(1) D and E only
(2) B and C only
(3) A and E only
(4) A and B only
Answer – (2) B and C only
- Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
1)6 bp
(3) 10 bp
(2) 4 bp
(4) 8 bp
Answer – 6 bp
- The cofactor of the enzyme carboxypeptidase is:
(1) Niacin
(2) Flavin
(3) Haem
4)Zinc (ANSWER) - Which of the following are required for the dark reaction of photosynthesis?
A. Light
B. Chlorophyll
C. CO₂
D. 60753
D. ATP
E. NADPH
Choose the correct answer from the options given below:
(1) B, C and D only
(2) C, D and E only (ANSWER)
(3) Dand E only
(4) A, B and Confy - During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of Fe2+ ion?
(1) concentrated sulphuric acid
(2) dilute nitric acid
(3) dilute sulphuric acid (ANSWER)
(4) dilute hydrochloric acid
- The plot of osmotic pressure (1) vs concentration (mol L-1) for a solution gives a straight line with a slope of 25.73 L, bar mol. The temperature at which the osmotic pressure measurement is done is: (Use R 0.083 L bar mol K
(1) 310°C
(3) 12.05°C
(2) 25.73°C
4)37°C (ANSWER)
- Identify the correct answer.
(1) BF; has non-zero dipole moment
(2) The dipole moment of NF, is greater than that of NH3 X
(3) Three canonical forms can be drawn for co-ion.
(4) Three resonance structures can be drawn for ozone - A transcription unit in DNA is defined primarily by the three regions in DNA and these are concerning upstream and downstream end;
(1) Structural gene, Transposons, Operator gene
(2) Inducer, Repressor, Structural gene
(3) Promotor, Structural gene, Terminator (ANSWER)
(4) Repressor, Operator gene, Structural gene - Identify the set of correct statements:
A. The flowers of Vallisneria are colorful and produce nectar. R
B. The flowers of waterlily are not pollinated by water,
C. In most of water-pollinated species, the pollen grains are protected from wetting. ✓
D. Pollen grains of some hydrophytes are long and ribbon-like.
E. In some hydrophytes, the pollen grains are carried passively inside water.
Choose the correct answer from the options given below:
(1) A, B, C and D only
(2) A, C, D and E only
(3)B, C, D and E only (ANSWER)
(4) C, D and E only - Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
1)Phospholipids (ANSWER)
(2) Glycerides
(3) Carbohydrates
(4) Amino acids - These are regarded as major causes of biodiversity loss:
A. Over exploitation
B. Co-extinction
C. Mutation
D. Habitat loss and fragmentations
E. Migration
Choose the correct option:
(1) A. B. C and D only
(2) A, B and E only
(3) A. B and D only(ANSWER)
(4) A. C and D only - Given below are two statements:
Statement 1: In the nephron, the descending limb of loop of Henleris impermeable to water and permeable to elettfolytes.
Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.
In the light of the above statements, choose the correct answer from the options given below:
(1) Both Statement I and Statement II are false (ANSWER)
(2) Statement is true but Statement II is false 7
(3) Statement 15 false but Statement II is true
(4) Both Statement I and Statement II are true - Given below are two statements: one is labeled as Assertion A and the other is labeled as Reason R:
Assertion A: Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.
Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) Both A and R are correct but R is NOT the correct explanation of A.
(2) A is correct but R is not correct.
(3) A is not correct nol correct but R is correct.
(4) Both A and are correct and R is the correet 10 explanation of A. (ANSWER) - Following are the stages of pathway for conduction of an action potential through the heart:
A. AV bundle
B. Purkinje fibres
C. AV nodem
D. Bundle bratches
E. SA node
Choose the correct sequence of pathway from the options given below:
(1) A-E-C-B-D
(2) B-D-E-C-A
(3) E-A-D-B-C
(4) E-C-A-D-B (ANSWER)
- Which one is the correct product of DNA-dependent RNA polymerase to the given
template? 5 AUGUAL GUA 3’TACATOGCAMATATOCATICAS
(1) 5’AUGUAAAQUUUAUAGGUAAGU3K
(2) S’AUGUACCGUUUAUAGGGA AGU3
(3) 5’ATGTACCGTTTATAGGTAAGT3’X
(4) S’AUGUACCGUUUAUAGGUA AGUS (ANSWER) - The “Ti plasmid of Agrobacterium tumefaciens stands for
(1) Tumor independent plasmid
(2) Tumor-inducing plasmid (ANSWER)
(3) Temperature independent plasmid
(4) Tumour inhibiting plasmid - Which of the following is not a natural/traditio contraceptive method?
(1) Periodic abstinence
(2) Lactational amenorrhea
(3)Vaults (ANSWER)
(4) Coitus interruptás - The DNA present in the chloroplast is:
1)Circular, double Stranded (ANSWER)
(2) Linear, single stranded
(3) Circular, single stranded
(4) Linear, double stranded
NEET 2024 Question Paper PDF Based Solutions for All Codes
Practicing the neet 2024 question paper pdf enables proper time management skills for students. As the NEET UG exam is administered in an OMR sheet in offline modes, it is very effective if students practice the neet 2024 question paper pdf with time. In this arrangement, they will get the feel of a real exam environment.
NEET Paper 2024 Exam Timing
The NEET 2024 has conducted on May 5, 2024, from 2 PM to 5.20 PM, NEET Question Paper is provided in 13 languages. A total of 200 questions are asked but students need to attempt only 180 questions. No extra marks will be given for extra attempts. Students can score a maximum of 720 marks. They have to choose correct answers on the NEET OMR sheets. If any option is chosen by mistake, that will not be modified anymore. So it crucial to be very attentive during our filling process.
NEET 2024 Paper Structure
Here let’s check out the NEET question paper pattern, how much questions were asked from all the sections.
NEET Question Paper | |||
Subjects | Section | No of Questions | Marks |
Botany
|
Section A | 35 | 140 |
Section B | 15 | 40 | |
Zoology
|
Section A | 35 | 140 |
Section B | 15 | 40 | |
Physics
|
Section A | 35 | 140 |
Section B | 15 | 40 | |
Chemistry
|
Section A | 35 | 140 |
Section B | 15 | 40 | |
720 |
NEET Question Paper Detailed Solution PDF