NEET 2024 Question Paper PDF Download for UG Exam

The National Testing Agency publishes the NEET Question Paper 2024 PDF at the official website of NTA at https://exams.nta.ac.in/NEET/. Students can understand the NEET questions’ difficulty level and important areas of the NEET syllabus by analyzing the NEET 2024 Question Paper.

NEET 2024 Question Paper

NEET 2024 Question Paper exam was conducted on May 5. The National eligibility cum entrance exam is held in a single shift. From 2 pm the National Merit Cum Entrance Test starts. Students are given 3 hours 20  minutes to solve the NEET Question Paper 2024. The NEET 2024 Question Paper comprises questions from 4 subjects – Zoology, Botany, Physics and Chemistry. 50 questions were asked from each subject. In each subject, there are 2 sections, Section A consists of 35 questions and section B consists of 15 questions out of which 10 must be attempted.

NEET Question Paper 2024 UG Exam Difficulty Level

The NEET Question paper 2024 was of moderate level. In each subject, the maximum mark in section A is 140 and a student can score a maximum of 40 marks in section B. Let’s review how was the NEET Question Paper 2024 PDF.

NEET 2024 Question Paper PDF Download

We will soon publish the NEET 2024 Question Paper PDF Download links here in this section. NEET 2024 question paper PDFs are significant for aspiring students who will take the NEET UG entrance exam next year. Practicing these questions PDF with solutions will help them to know the NEET Exam Pattern and difficulty level very well. Get the 2024 NEET question paper PDF from the links below.

NEET Question Paper 2024 PDF Download Link

NEET 2024 Question Paper PDF Download Paper Code T1

NEET UG 2024 Question Paper Set – Paper Code R3

Don’t Forget to See – NEET Paper Analysis 2024 by Experts

2024 NEET Question Paper

Students are eagerly waiting for the NEET 2024 Paper with answers. So that they can verify their answers and calculate probable scores. Many coaching institutes publish NEET answer keys for the convenience of the students but the answers to the NTA NEET answer key will be regarded as final answers.

Download – NEET Question Paper with Answer key

NEET UG 2024 Question Paper with Solutions

NEET UG  2024 question paper with Solution is complete based on the NEET updated syllabus. The NEET syllabus has undergone many changes this year.  So this year’s NEET 2024 Question paper is a blueprint to guide all the future NEET aspirants.

NEET Exam 2024 Question Paper with Answers

• Which of the following is an example of an actinomorphic flower?
  (1) Cassia
  (2) Pisum
  (3) Sesbania
  4 Datura

Answer – 4) Datura.

• What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?
  A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.
  B. It may get integrated into the genome of the recipient and be inherited along with C. It may multiply and the host DNA.
  D. The alien piece of DNA is not an integral part of the chromosome.
  E. It shows the ability to replicate.
  Choose the correct answer from the options given below:
  (1) D and E only
  (2) B and C only
  (3) A and E only
  (4) A and B only

Answer – (2) B and C only

• Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
  1)6 bp
  (3) 10 bp
  (2) 4 bp
  (4) 8 bp

Answer – 6 bp

• The cofactor of the enzyme carboxypeptidase is:
  (1) Niacin
  (2) Flavin
  (3) Haem
  4)Zinc (ANSWER)
• Which of the following are required for the dark reaction of photosynthesis?
  A. Light
  B. Chlorophyll
  C. CO₂
  D. 60753
  D. ATP
  E. NADPH
  Choose the correct answer from the options given below:
  (1) B, C and D only
  (2) C, D and E only (ANSWER)
  (3) Dand E only
  (4) A, B and Confy
• 
• 
• During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of Fe2+ ion?

(1) concentrated sulphuric acid
(2) dilute nitric acid
(3) dilute sulphuric acid (ANSWER)
(4) dilute hydrochloric acid

• The plot of osmotic pressure (1) vs concentration (mol L-1) for a solution gives a straight line with a slope of 25.73 L, bar mol. The temperature at which the osmotic pressure measurement is done is: (Use R 0.083 L bar mol K

(1) 310°C
(3) 12.05°C
(2) 25.73°C
4)37°C (ANSWER)

• Identify the correct answer.
  (1) BF; has non-zero dipole moment
  (2) The dipole moment of NF, is greater than that of NH3 X
  (3) Three canonical forms can be drawn for co-ion.
  (4) Three resonance structures can be drawn for ozone
• A transcription unit in DNA is defined primarily by the three regions in DNA and these are concerning upstream and downstream end;
  (1) Structural gene, Transposons, Operator gene
  (2) Inducer, Repressor, Structural gene
  (3) Promotor, Structural gene, Terminator (ANSWER)
  (4) Repressor, Operator gene, Structural gene
• Identify the set of correct statements:
  A. The flowers of Vallisneria are colorful and produce nectar. R
  B. The flowers of waterlily are not pollinated by water,
  C. In most of water-pollinated species, the pollen grains are protected from wetting. ✓
  D. Pollen grains of some hydrophytes are long and ribbon-like.
  E. In some hydrophytes, the pollen grains are carried passively inside water.
  Choose the correct answer from the options given below:
  (1) A, B, C and D only
  (2) A, C, D and E only
  (3)B, C, D and E only (ANSWER)
  (4) C, D and E only
• Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
  1)Phospholipids (ANSWER)
  (2) Glycerides
  (3) Carbohydrates
  (4) Amino acids
• These are regarded as major causes of biodiversity loss:
  A. Over exploitation
  B. Co-extinction
  C. Mutation
  D. Habitat loss and fragmentations
  E. Migration
  Choose the correct option:
  (1) A. B. C and D only
  (2) A, B and E only
  (3) A. B and D only(ANSWER)
  (4) A. C and D only
• 
• 
• Given below are two statements:
  Statement 1: In the nephron, the descending limb of loop of Henleris impermeable to water and permeable to elettfolytes.
  Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.
  In the light of the above statements, choose the correct answer from the options given below:
  (1) Both Statement I and Statement II are false (ANSWER)
  (2) Statement is true but Statement II is false 7
  (3) Statement 15 false but Statement II is true
  (4) Both Statement I and Statement II are true
• Given below are two statements: one is labeled as Assertion A and the other is labeled as Reason R:
  Assertion A: Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.
  Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby.
  In the light of the above statements, choose the most appropriate answer from the options given below:
  (1) Both A and R are correct but R is NOT the correct explanation of A.
  (2) A is correct but R is not correct.
  (3) A is not correct nol correct but R is correct.
  (4) Both A and are correct and R is the correet 10 explanation of A. (ANSWER)
• Following are the stages of pathway for conduction of an action potential through the heart:
  A. AV bundle
  B. Purkinje fibres
  C. AV nodem
  D. Bundle bratches
  E. SA node
  Choose the correct sequence of pathway from the options given below:
  (1) A-E-C-B-D
  (2) B-D-E-C-A
  (3) E-A-D-B-C

(4) E-C-A-D-B (ANSWER)

• Which one is the correct product of DNA-dependent RNA polymerase to the given
  template? 5 AUGUAL GUA 3’TACATOGCAMATATOCATICAS
  (1) 5’AUGUAAAQUUUAUAGGUAAGU3K
  (2) S’AUGUACCGUUUAUAGGGA AGU3
  (3) 5’ATGTACCGTTTATAGGTAAGT3’X
  (4) S’AUGUACCGUUUAUAGGUA AGUS (ANSWER)
• The “Ti plasmid of Agrobacterium tumefaciens stands for
  (1) Tumor independent plasmid
  (2) Tumor-inducing plasmid (ANSWER)
  (3) Temperature independent plasmid
  (4) Tumour inhibiting plasmid
• Which of the following is not a natural/traditio contraceptive method?
  (1) Periodic abstinence
  (2) Lactational amenorrhea
  (3)Vaults (ANSWER)
  (4) Coitus interruptás
• The DNA present in the chloroplast is:
  1)Circular, double Stranded (ANSWER)
  (2) Linear, single stranded
  (3) Circular, single stranded
  (4) Linear, double stranded
• 

NEET 2024 Question Paper PDF Based Full Solutions

Practicing the neet 2024 question paper pdf enables proper time management skills for students. As the NEET UG exam is administered in an OMR sheet in offline modes, it is very effective if students practice the neet 2024 question paper pdf with time. In this arrangement, they will get the feel of a real exam environment.

NEET Exam Timing 2024

The NEET 2024 has conducted on May 5, 2024, from 2 PM to 5.20 PM, NEET Question Paper is provided in 13 languages. A total of 200 questions are asked but students need to attempt only 180 questions. No extra marks will be given for extra attempts. Students can score a maximum of 720 marks. They have to choose correct answers on the NEET OMR sheets. If any option is chosen by mistake, that will not be modified anymore. So it crucial to be very attentive during our filling process.

NEET 2024 Question Paper Structure

Here let’s check out the NEET 2024 question paper pattern, how much questions were asked from all the sections.

NEET 2024 Question Paper Detailed Solution PDF

Sharing is caring!