hamburger menu
All Coursesall course arrow
adda247
reward-icon
adda247
    arrow
    arrow
    arrow
     Given below is one of the strands of a double-stranded DNA sequence: 5′–  ATGCGATGACGATGACGATGACGATGACGAACGATGAGATGG –3′ In th
    Question


     Given below is one of the strands of a double-stranded DNA sequence:
    5′–  ATGCGATGACGATGACGATGACGATGACGAACGATGAGATGG –3′
    In the absence of any other confounding factors (viz., length, Tm, etc.), which one of the following options represents the  primer combination that would amplify the above double-stranded template in a PCR?

    A.

    5′– TACGCTACT –3′ and 5′– ATGAGATGG –3′

    B.

    5′– ATGCGATGA –3′ and 5′– GGTAGAGTA –3′

    C.

    5′– TCATCGAT –3′ and 5′– CCACTCTCA –3′

    D.

    5′– ATGCGATGA –3′ and 5′– CCATCTCAT –3′

    Correct option is D


    Correct Answer:  (d)
    Explanation: In PCR, the forward primer is identical to the 5′ end of the given strand, while the reverse primer must be the reverse complement of the 3′ end. The given sequence starts with  ATGCGATGA, which matches the forward primer in option (d). The 3′ end of the sequence is  …GAGATGG, whose reverse complement is  CCATCTCAT, exactly matching the reverse primer in option (d). Thus, this primer pair will correctly amplify the target DNA fragment.
    Information Booster
    · PCR primers anneal in the 5′ → 3′ direction on opposite strands.
    · The forward primer matches the given strand sequence at the 5′ end.
    · The reverse primer is always the  reverse complement of the 3′ end of the target strand.
    · DNA polymerase extends primers only from a free 3′-OH group.
    · Correct primer orientation is essential for exponential amplification.
    Additional Knowledge
    Incorrect primer pairs either fail to match the exact 5′ start of the sequence or do not represent the proper reverse complement of the 3′ end. Even a perfectly complementary sequence will not work if it is written in the wrong orientation. This principle is fundamental in primer design for PCR, sequencing, and molecular diagnostics.

    Similar Questions

    test-prime-package

    Access ‘CSIR NET Life Sciences’ Mock Tests with

    • 60000+ Mocks and Previous Year Papers
    • Unlimited Re-Attempts
    • Personalised Report Card
    • 500% Refund on Final Selection
    • Largest Community
    students-icon
    383k+ students have already unlocked exclusive benefits with Test Prime!
    test-prime-package

    Access ‘CSIR NET Life Sciences’ Mock Tests with

    • 60000+ Mocks and Previous Year Papers
    • Unlimited Re-Attempts
    • Personalised Report Card
    • 500% Refund on Final Selection
    • Largest Community
    students-icon
    383k+ students have already unlocked exclusive benefits with Test Prime!
    Our Plans
    Monthsup-arrow